My brother sent me this article about altruism and pinpointing and predicting it in the brain using fMRI scanning.

What it started, was a simple thought process that ended up taking on a life of its own. Thus I wanted to get it down for posterity sake.

It's an interesting article. I came across it on http://www.eurekalert.org/ the other day but never read it. Quite a few of these functional magnetic resonant imaging (fMRI) studies are popping up lately I just haven't had the time. One reason is they only monitor active blood flow/synapse potential(electrical firing) density in clusters over long periods of time (1-3 seconds) at an accuracy of about a millimeter and are only really useful for comparison purposes to get a rough idea of where tasks are active in different parts of the brain. Thing is as I'm finding we're all wired a little differently, sometimes a lot depending on the part of the brain, and that resolution, while good for hypothesis on how we work, isn't detailed enough for me to gain an understanding as to why we work and are built a certain way.

Thus I'm learning about neurons at the moment and how they store memory. Basically the more you react to stimulus (called sensitisation) and a form of learning where you learn to ignore innocuous stimulus (called habituation). Combine the two and you have conditional learning. Interestingly its the synapses already connecting one neuron to another that strengthen and weaken, not new connections being formed when performing sensitisation. I need to finish reading the Kandel article but I think its the same for habituation… I'm also learning about how, where and why new neurons form and do connect. From birth they seem to work in clusters and send out connectors (axon) and waves of exploratory signals along them that stop sending once they find something they connect with that responds in a way they expected according to Shatz. Like calling everyones telephone until you connect to the right person and then adding them to autodial for whenever you have a message to send, all done through strengthening selective synapse connections to other neurons while weakening others. Alternatively think of it as internet messaging where weakening synapses is used as a form of spam prevention because in the brain neuron spikes(the voltages the fMRI picks up) may be heard from neighbouring neurons. Also no neuron is the same and each probably have their own signature like an IP address eg. 192.168.1.77 only it probably looks like ACTGATGCATAGATAGATAAC, while types of neurons (clusters) are subnets of that IP address. eg. 192.168.1.* And that those subnets are signatures stored in our genes so that as different cells grow they can find other cells to talk to and connect with to form the functional beings we are.

Imagine your a nerve cell that has been cultured in a dish and injected into the skin of someone and your not connected to anything yet. Then one day something presses up against you and causes you to enough pain to threaten your existence. Your going to send out a signal and complain right, and your neighbours(if they hear you), in order to get you to shut up, will send messages further until they get to the cell in charge who tells everyone else what to do next. Over time neural highways form, structure (who talks to who and who listens) is then encoded in cells that talk a lot back and forth. An example of being encoded with information being adult stem cells. Recently they've even found intermediate stem cells.
It has been shown that synapses over time when conditional learning happens (both sensitisation and habituation) cause the nucleus of the neurons to synthesise proteins. Are they simply changing their IP address from say 192.168.1.10 to 192.168.2.1 and forming a biological component hierarchy in this process? They may well be. And that the letters: ACTG, what are called the bases in Genome sequencing and used to construct the name GATTACA and my blog name CATAGA - are in fact the subnet code.

Are you asleep yet? If not did you like my hypothesis? It's a work in progress. (I came up with it as I typed this message to my brother)

 New fMRI research from Vanderbilt neuroscientists gives insight into the limits of multi-tasking in the brain.

The results revealed that the central bottleneck was caused by the inability of the lateral frontal and prefrontal cortex, and also the superior frontal cortex, to process the two tasks at once. Both areas have been shown in previous experiments to play a critical role in cognitive control.

"We determined these brain regions responded to tasks irrespective of the senses involved, they were engaged in selecting the appropriate response, and, most importantly, they showed 'queing' of neural activity–the neural response to the second task was postponed until the response to the first was completed," Dux said.

"Neural activity seemed to be delayed for the second task when the two tasks were presented nearly simultaneously – within 300 milliseconds of each other," Marois said. "If individuals have a second or more between tasks, we did not see this delay.

Based on memory work I've read I'd postulate that neurons required for multiple tasks, block synapse unrelated to the current task based on temporal information it receives and later predicts. That the "queueing" shown is a simple battery of requested actions on different synapse from other circuits in the brain. And that priority is given next to the most active synapse.

I need to think about this further when my head is clearer.

On Reflection: My guess is that blood flow to certain parts of my brain ain't what it should be and helping me relax tense muscles, fixes that. Especially neck. The change in my visual field is an interesting one. My vision tends to get hazy or fuzzy, cloudy snow…and when it's bad(which last was a long-long time ago) I get striking lines across my vision, I start to internally vibrate, sweat? feel light headed, etc. I used to have to sleep them off. Fresh cold air and sleep the only thing that helped. Since learning(myself) to massage my neck and manipulate it and any tense areas I've managed to control the initial foggy head indicator and avert anything worse than a little cloudy snow.

So it affects my vision, my cognitive ability(feeling light headed), something triggers my hypothalamus into releasing a stimulant(internal vibrations/sweat/pulse?). On that I'm wondering if its a reduction in blood flow to the cortex and a reflex action. The cortex handling vision comprehension, my cognitive ability and consciousness. My readings on synesthesia indicate reduced blood flow can potentially explain sensory(my vision) changes. Right now my cognition in spelling is horrendous, I'm relying heavily on Firefox to fix my mistakes.

I need to relax for a bit again. Hmm. What's making me tense?

So… laying down potentially provides more blood pressure for parts of my brain as well as relaxes my muscles that may be impinging on arteries and blood flow. Dense cold air equals more oxygen and may explain why I always sought out cool fresh air.
I just remembered how my hearing can in turn be effected, I become noise sensitive, sometimes hear high pitch sounds.

It's blood flow to the cortex. What else could it be? I mean other than insanity. Tee hee! Oh shit, I joked! My prefrontal cortex must be struggling.

Did you hear the one about the railway worker and the hot iron through the eye and out the top of his head? After all the damage to his prefrontal cortex he became crass and impulsive and a non-stop joker. 

I watched an autism documentary last night on SBS Australia entitled "The Woman Who Thinks like a Cow". What I found fascinating were her insights into her own narrow breadth of emotions and how she related to animals more easily than humans because of that. At that moment the thought occurred to me that the reduced density of neurons in the amygdala of autism subjects, something I'd just recently read about, could be a likely cause for her limited emotional responses. One can then speculate the likelihood then of that significantly affecting the development of other parts of the brain in the process. This link struck me after seeing and hearing about the reduced connectivity of the overall brain in autistic subjects as they described in the documentary. I've also read recently about conjecture as to whether the reduction in neurons in the amygdala is a cause or a symptom of autism. My hypothesis is that it's a cause, and that as autistic people develop, their brains make fewer neural connections in higher levels of the brain because of the reduced breadth of emotion memory the amygdala is capable of storing. What's interesting for me however is what I believe happens as we develop and the ability of the higher levels in the brain, namely the cortex, to learn to reason with lower level functions of the brain or inhibit parts of it. The example I give is the often wild and uncontrolled emotional outbursts from autistic people when young that in time through development can be reduced in severity as the example shown in the documentary illustrates.

What I loved though was the squeezer used in order to reform old patterned beliefs and associate them with pleasure and calming centres of the brain through pressure stimulus.

I've begun to believe that the weight of the sensory stimulus has a huge bearing on memory and what we remember. I've read of savants with photographic memory whom have been diagnosed with synesthesia, a union of the senses. That has therefore led me to believe that the greater the weight in sensory areas, the more likely we are to recall events. Additionally, associating that sensory weight with emotional events then go hand in hand. The weight of emotion being the driving force in motivation. And think about this; the more anxious you get, the more weight you give to your sensors!

Thinking this thought my framework of how the brain works is slowing beginning to form. It's amazing just how much what I've learnt in the past month has changed the way I view the world.

That's my take after reading Amnesiacs struggle to imagine future events:

People with amnesia have difficulty imagining future events with any richness of detail and emotion, a new study reveals. The finding adds to a growing body of evidence suggesting that memories help people visualise the future.

Eleanor Maguire at the Wellcome Trust Centre for Neuroimaging in London, UK, and colleagues studied five patients who suffered from classic amnesia. The patients had all suffered infections that had damaged a brain region called the hippocampus. The damage left the subjects unable to recall past events, although they could remember facts such as the names of their relatives.

My belief is that in order to predict the future we need to be able to distribute our belief of what that future may be based on facts we already believe, so that other regions of the brain can allow for those beliefs in forming new ones. According to this study subjects could remember facts (memories stored in the hippocampus and linked to in other areas of the brain) but not past events. My hypothesis is that the feedback loop to some higher levels of brain function(potentially the sensory heirarchy that stores temporal patterns) critical to prediction, breakdown in areas of the amnesiac hippocampus.

The more I think about areas such as the hippocampus and amygdala, the more I believe that as we develop, functions migrate from lower levels into cortical areas of the brain where the real cognitive work done, and then fed lower in a feedback cycle where it's acted upon.

Alas, right now I've not thinking straight to ponder further in detail, my vision feels a little cloudy and my head heavy. Like the onset of a migraine. Thought I'd better jot this thought down before I forget it! I'm off to massage my neck and relax. Usually does the trick!

Put simply; the interface.

• Numbers on search results? Why do I care about that as an end user? They inhibit result scanning making me stop on them instead of the results!
• I'm lucky to get 5 search results on a page versus 9 on Google.
• Font colour contrast is weak when it comes to guiding my eye to important navigational/instructional content.
• No dates on links whatsoever to help guide my contextual searching.
• No local location context search results in default search.
• No killer feature to differentiate it from other search engines.

A nice killer feature I'd like my search engine to have is current news results in the right-hand column based on my search results.

• It requires PHP 5.1.0+
• The admin panel looks great
• I'm tired of K2
• It's responsive
• Has lots to be done.
• I also learnt that under windows PHP 5.2.0 has buggy extensions that caused memory cannot be "read" error messages from Apache. Lesson: Only install what you need! That's PDO and in my case the MySQL PDO driver.

With many great minds focused on this, I look forward to seeing this project evolve.

Is it just me or after having used Google Video a lot recently - that in comparison YouTubes video search STINKS.

Gah! God I'm in a bad mood. I hate being physically ill and then have to put up with such shitty user experience.